rs612469 chr19:34220435 G>C
- Sequence
aagtaggacctttttttcacccct[G/C]tatgttacagttcaaatgaagcca
- ASB in cell types
- A549 (lung carcinoma) K562 (myelogenous leukemia) bipolar neuron IPSC-derived bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.75 | -0.33 | 1.76 | |||
| K562 (myelogenous leukemia) | 0.42 | -0.13 | 2.00 | |||
| bipolar neuron | -1.15 | 1.29 | 1.00 | |||
| IPSC-derived bipolar neuron | -0.82 | 1.18 | 1.00 |
Items per page:
1 – 4 of 4