rs6125096 chr20:47740951 C>T
- Sequence
gtacttgggcaatcatcttggcta[C/T]ggttcctcccatctttcagttccc
- ASB in cell types
- monocyte-derived dendritic cells CD14+ monocytes GM12878 (female B-cells) periferal blood macrophages
- ASB for transcription factors
- SPI1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.04 | -0.58 | 2.00 | n/a | No Hit | |||
| STAT1_HUMAN | 1.22 | n/a | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2