rs6130412 chr20:43537082 G>A
- Sequence
cacttgcccaaggtcattcacctt[G/A]taagggggagagctggcattccaa
- ASB in cell types
- HepG2 (hepatoblastoma) SK-BR-3 (breast adenocarcinoma)
- ASB for transcription factors
- ERR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ERR1_HUMAN | -0.18 | 1.39 | 2.00 | -2.73 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
