rs613158 chr1:54220791 C>T
- Sequence
gagcacgctgcagggagagtgctg[C/T]gccgggtcatgctggatagcgaaa
- ASB in cell types
- periferal blood macrophages monocyte-derived dendritic cells CD14+ monocytes monocyte-derived macrophages
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.83 | n/a | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellum, Brain_Cortex, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg