rs6133879 chr20:10359663 C>T
- Sequence
attaactcagtctataaataacct[C/T]gaaaaaataataaacaacagtctt
- ASB in cell types
- GM12878 (female B-cells) primary endothelial colony-forming cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.42 | 0.69 | 1.23 | |||
| primary endothelial colony-forming cells | n/a | 1.43 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, neuroblastoma (brain cancer), nicotine dependence (smoking), sporadic creutzfeldt-jakob disease, triglycerides