rs613559 chr8:102918952 G>A
- Sequence
tgttcacgaggagataataacctg[G/A]ttatgcccaacggaatctgtatca
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.90 | -0.18 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, hdl cholesterol, irritible bowel syndrome, schizophrenia, spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease, triglycerides, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Nerve_Tibial, Pancreas, Testis