rs6138281 chr20:2508885 G>A
- Sequence
gccgcggaggccgcgctcaccaga[G/A]ccagcgtgcccgggatctcggcca
- ASB in cell types
- HEK293 (embryonic kidney) T47D (invasive ductal carcinoma) breast tumor tissue
- ASB for transcription factors
- ESR1_HUMAN HIF1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.27 | -0.18 | 2.00 | -2.90 | Concordant | |||
| HIF1A_HUMAN | 2.10 | -2.75 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood