rs614081 chr6:142693097 G>A
- Sequence
atcttctaggccatcttctccaca[G/A]tgatttttatcagcgacggccccc
- ASB in cell types
- A549 (lung carcinoma) K562 (myelogenous leukemia) erythroid cells GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.60 | 0.40 | 1.16 | |||
| K562 (myelogenous leukemia) | 0.38 | 0.44 | 1.30 | |||
| erythroid cells | 2.13 | -2.77 | 2.00 | |||
| GM12878 (female B-cells) | 0.39 | 0.49 | 1.36 | |||
| neutrophils | 0.05 | 1.88 | 1.50 |
Items per page:
1 – 5 of 6