rs614120 chr6:90286261 C>G
- Sequence
ttactttcaaacccacaatatcaa[C/G]acgcttaacataagtggaaattta
- ASB in cell types
- K562 (myelogenous leukemia) periferal blood macrophages germinal center B-cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.51 | -0.27 | 2.02 | |||
| periferal blood macrophages | -1.02 | 1.37 | 2.00 | |||
| germinal center B-cells | 1.16 | 0.51 | 2.00 |
Items per page:
1 – 3 of 3