rs615468 chr1:84254046 A>G
- Sequence
ccctgtgaagacaagtgccccttt[A/G]tgcctgttccttccatttttagac
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.08 | 0.74 | 1.99 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, diabetic retinopathy in type 2 diabetes mellitus, obesity with early age of onset (age >2)