rs616529 chr5:139660244 G>C
- Sequence
gggtgccttgtcgagggcctgcag[G/C]ctcaaagaggctctggtggagtgt
- ASB in cell types
- HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293T (embryonic kidney) | -0.74 | 1.31 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, diabetic retinopathy in type 2 diabetes mellitus, height, years of education