rs616714 chr11:75333596 G>T
- Sequence
cacctactgtgtaccaggcactgt[G/T]ttaagccatgcattatctcattta
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.14 | 0.47 | 1.80 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, ldl cholesterol change with statins, major depressive disorder (narrow definition), major depressive disorder (narrow definition) (females), neuroblastoma (brain cancer), stabilized warfarin dose, total cholesterol change with statins