rs617182 chr17:49229912 G>A
- Sequence
aggagtctctggcgcctcttggga[G/A]aattgcagctggagctcccccctt
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 1.64 | n/a | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, acute lung injury following major trauma, asthma, diastolic blood pressure (dbp), hdl cholesterol change with statins, irritible bowel syndrome, ldl cholesterol, spine bone mineral density (bmd), systolic blood pressure (sbp)