rs617599 chr1:160193169 G>A
- Sequence
acatggctaggtgctggagggaag[G/A]ggagtcggggaatacaggcggggc
- ASB in cell types
- KMS-11 tibial artery
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| KMS-11 | 2.81 | n/a | 5.00 | |||
| tibial artery | 0.87 | -0.87 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Esophagus_Muscularis, Nerve_Tibial, Ovary, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood