rs61801971 chr1:33350098 A>T
- Sequence
gcttagggaggcgggcgccacgcc[A/T]cgaggaggctgccctgatagccgg
- ASB in cell types
- HepG2 (hepatoblastoma) cranial neural crest cells NCI-H2171 (small cell lung carcinoma)
- ASB for transcription factors
- MAX_HUMAN AP2A_HUMAN MYC_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MAX_HUMAN | 1.08 | -0.08 | 1.38 | -5.96 | Concordant | |||
| AP2A_HUMAN | 2.59 | n/a | 2.00 | n/a | No Hit | |||
| MYC_HUMAN | 1.35 | -0.11 | 1.37 | -2.97 | Concordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Muscle_Skeletal, Prostate, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood