rs61802998 chr1:161621752 G>A
- Sequence
gttcgttcccaccccgggacagaa[G/A]tcccacttttgtgaaccttgagtt
- ASB in cell types
- foreskin keratinocyte
- ASB for transcription factors
- TBP_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TBP_HUMAN | 2.25 | -2.30 | 1.33 | n/a | No Hit | |||
| CTCF_HUMAN | -0.67 | 1.19 | 1.46 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood