rs618964 chr12:3275733 G>C
- Sequence
tgcccattctttgggagccctgac[G/C]tggttccatgtggggctgcgccag
- ASB in cell types
- foreskin keratinocyte upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.32 | n/a | 2.67 | |||
| upper lobe of left lung | 0.67 | -0.09 | 1.11 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Heart_Atrial_Appendage, Thyroid