rs61908576 chr12:58385 C>A
- Sequence
acctgacaaagacaaagaaaagag[C/A]attttaaaaatgaacaaagcctcc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HepG2 (hepatoblastoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.33 | 1.05 | 1.63 | |||
| HepG2 (hepatoblastoma) | 0.10 | 1.24 | 1.57 | |||
| K562 (myelogenous leukemia) | -0.18 | 0.61 | 2.04 |
Items per page:
1 – 3 of 3