rs61931217 chr12:114806718 T>C
- Sequence
catttctcctcttgtacttagaaa[T/C]ggacacatagacaggatgtggccc
- ASB in cell types
- periferal blood macrophages monocyte-derived dendritic cells liver
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| periferal blood macrophages | 1.49 | n/a | 2.50 | |||
| monocyte-derived dendritic cells | 2.11 | -2.74 | 2.00 | |||
| liver | 0.94 | -0.04 | 1.33 |
Items per page:
1 – 3 of 3