rs619398 chr3:109818474 C>T
- Sequence
ttgccacatgctaccaagagatag[C/T]gcatgtgatagactacagaatagg
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- MNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MNT_HUMAN | 3.00 | -3.66 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, college completion, ldl cholesterol, triglycerides, years of education