rs61942053 chr12:48682201 T>G
- Sequence
gccatcttacctcaggagctgcgc[T/G]gcgccgcactctgccgcgccgctc
- ASB in cell types
- K562 (myelogenous leukemia) fetal bone marrow-derived mononuclear cells foreskin keratinocyte CD14+ monocytes
- ASB for transcription factors
- KMT2A_HUMAN STAT1_HUMAN NFE2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KMT2A_HUMAN | 2.29 | 0.03 | 1.20 | n/a | n/a | |||
| STAT1_HUMAN | 1.07 | -0.86 | 2.50 | n/a | No Hit | |||
| NFE2_HUMAN | 1.78 | n/a | 1.50 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hippocampus, Breast_Mammary_Tissue, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid