rs61994920 chr14:36656058 C>T
- Sequence
tataggtggcgctgtgacaaggtg[C/T]ggtggccgggagaggcggctgggg
- ASB in cell types
- lymphoblastoid cells OVCAR8 (high grade ovarian serous adenocarcinoma) GM12878 (female B-cells) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| lymphoblastoid cells | 2.00 | n/a | 1.33 | |||
| OVCAR8 (high grade ovarian serous adenocarcinoma) | -1.68 | 2.06 | 2.00 | |||
| GM12878 (female B-cells) | 0.88 | 0.37 | 1.35 | |||
| HepG2 (hepatoblastoma) | 0.08 | 0.51 | 1.88 | |||
| GM12892 (female B-cells) | 1.95 | n/a | 1.50 |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg