rs620019 chr1:63775258 T>C
- Sequence
tgcatatttgattttggtaatctc[T/C]aaagacaatcgcaacagttagaga
- ASB in cell types
- HEK293 (embryonic kidney) HUES64 (embryonic stem cells) HEK293T (embryonic kidney)
- ASB for transcription factors
- OTX2_HUMAN ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OTX2_HUMAN | 2.25 | -1.99 | 1.33 | n/a | No Hit | |||
| ZFX_HUMAN | 1.50 | -0.10 | 1.39 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, bipolar disorder, diabetic retinopathy in type 2 diabetes mellitus, waist hip ratio