rs62019416 chr15:100873214 T>C
- Sequence
gttgggaaatacctgcttctctca[T/C]agaaggaacttcagtggcaacttc
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells) epidermal keratinocytes T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.27 | 0.75 | 2.03 | |||
| GM12878 (female B-cells) | 0.32 | 0.76 | 1.34 | |||
| epidermal keratinocytes | 2.14 | -1.97 | 2.00 | |||
| T47D (invasive ductal carcinoma) | 1.14 | -0.50 | 2.00 |
Items per page:
1 – 4 of 4