rs62046880 chr16:88052865 C>A
- Sequence
ttatcaccaacacaaccaccctaa[C/A]aatcactaccaccaccaccttctt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HepG2 (hepatoblastoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.00 | 0.14 | 1.77 | |||
| HepG2 (hepatoblastoma) | -0.07 | 0.94 | 2.00 | |||
| K562 (myelogenous leukemia) | n/a | 1.63 | 2.50 |
Items per page:
1 – 3 of 3