rs62057454 chr17:33972655 T>C
- Sequence
ctaaggtgtgaaaagctcaattag[T/C]tgtctgtgatcacacatcacgcct
- ASB for transcription factors
- OTX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OTX2_HUMAN | 0.88 | -0.02 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellum, Colon_Transverse, Heart_Left_Ventricle, Skin_Sun_Exposed_Lower_leg