rs62063125 chr17:65294314 G>T
- Sequence
caccaggctctcggtggaatgggg[G/T]ccctgagccacgttcctgggtttc
- ASB in cell types
- epidermal keratinocytes
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.93 | 0.17 | 1.41 | n/a | No Hit |
Items per page:
1 – 1 of 1