rs62082980 chr17:69569275 C>G
- Sequence
gcaggaacatttcgctgtgtctta[C/G]gaaggcaaacgaaagaacgaatta
- ASB in cell types
- erythroid cells B-cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 1.93 | -1.87 | 1.50 | |||
| B-cells | 1.87 | -1.70 | 2.00 |
Items per page:
1 – 2 of 2