rs62106563 chr19:6273851 G>C
- Sequence
ctcggccgacttcccggcatttct[G/C]atgacagggagttcctacccaggg
- ASB in cell types
- breast tumor tissue HEK293 (embryonic kidney) periferal blood macrophages
- ASB for transcription factors
- ESR1_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.80 | 0.29 | 2.25 | n/a | No Hit | |||
| SPI1_HUMAN | 1.18 | 0.23 | 2.07 | n/a | No Hit |
Items per page:
1 – 2 of 2