rs62127764 chr19:55341345 C>G
- Sequence
gggcttcacccggagcctcctgac[C/G]actcccgaaggctgccggggaggc
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.59 | 0.12 | 1.87 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Colon_Transverse, Esophagus_Mucosa, Lung, Nerve_Tibial, Stomach, Thyroid, Whole_Blood