rs62133148 chr2:37157153 A>C
- Sequence
ttggcaccggcaggcgggcttggc[A/C]cccacgtgctgcccctgcacggcc
- ASB in cell types
- SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | 1.20 | -0.25 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Colon_Transverse, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Spleen, Thyroid