rs62142835 chr2:39144150 G>T
- Sequence
ttgtccttttgtgtctgacttctt[G/T]cacttagcatgatgttttcaaagt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.43 | -0.18 | 1.99 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Stomach, Whole_Blood