rs62158170 chr2:113324598 A>G
- Sequence
tggctcagggcatagagggggctc[A/G]ggacacatggagcaccccctcgcc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.21 | -0.28 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI diastolic blood pressure, insomnia, insomnia symptoms (never/rarely vs. sometimes/usually), insomnia symptoms (never/rarely vs. usually), sleep duration
GTEx eQTL Adrenal_Gland, Cells_Cultured_fibroblasts, Lung, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid