rs62219349 chr21:41610603 C>T
- Sequence
tacgtgtccagtcccctaggtcct[C/T]ggtcccctagcagatagaaggtcc
- ASB in cell types
- esophagus muscularis mucosa HeLa Kyoto (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| esophagus muscularis mucosa | 1.51 | -1.32 | 1.00 | |||
| HeLa Kyoto (cervical adenocarcinoma) | -0.18 | 0.75 | 2.00 |
Items per page:
1 – 2 of 2