rs62234703 chr3:31532766 A>C
- Sequence
gatggctagtggggcgccggggcc[A/C]tctgggttgagagagcggcgattg
- ASB in cell types
- A549 (lung carcinoma) breast tumor tissue
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.22 | -1.89 | 2.00 | 1.68 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
