rs62335812 chr5:1884042 G>A
- Sequence
gagcgcccaccccaggactccctc[G/A]gccagtaccctccctgggaccttg
- ASB in cell types
- H1 (embryonic stem cells) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H1 (embryonic stem cells) | 1.15 | -0.44 | 1.00 | |||
| foreskin keratinocyte | 0.99 | -0.44 | 1.44 |
Items per page:
1 – 2 of 2