rs62336791 chr4:52862012 C>G
- Sequence
cggaggcagcggtccggaatggct[C/G]tgtggaggctgcgctctcttcctg
- ASB in cell types
- K562 (myelogenous leukemia) cranial neural crest cells
- ASB for transcription factors
- AP2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AP2A_HUMAN | 1.86 | -1.43 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1