rs623738 chr3:107525512 T>C
- Sequence
gtggtatttgcacttcattttttc[T/C]tcccccctctttcccaaagcaaga
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.54 | 0.37 | 1.47 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, irritible bowel syndrome, rheumatoid arthritis, schizophrenia, spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease, years of education