rs62456537 chr7:55255113 C>T
- Sequence
gaaggcgggagccgggttccctgc[C/T]ggtggagccggcggctcagccggg
- ASB in cell types
- foreskin keratinocyte stem and progenitor cells
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.01 | -0.21 | 1.90 | 0.16 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
