rs625405 chr7:4144404 T>G
- Sequence
cagacacctgcgcctagaggtggc[T/G]gcgtcatggacagggcagggcgtg
- ASB in cell types
- cranial neural crest cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| cranial neural crest cells | -2.97 | 1.61 | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, parkinsons disease, total cholesterol, waist hip ratio