rs626492 chr15:48551401 C>T
- Sequence
atttgttctaagttatctctactc[C/T]cttgcctggccttttgttaaaaac
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.01 | 0.84 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, aortic dissection, ascending aortic dissection, descending aortic dissection, ldl cholesterol change with statins, sporadic thoracic aortic aneurysms and dissections, sporadic thoracic aortic aneurysms and dissections without bicuspid aortic valve, total cholesterol change with statins