rs628643 chr11:126147639 G>A
- Sequence
gcggcagcgtccccctgcagaggg[G/A]ctccccagacaccagagggaccgt
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.17 | 0.57 | 1.23 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, infant head circumference, serum creatinine, total cholesterol change with statins, triglycerides change with statins