rs629278 chr11:107799452 C>T
- Sequence
aaacaccagcacccctagtggtgg[C/T]cagatgaaatgcagccacggcatc
- ASB in cell types
- CD34+ hematopoietic stem cells epidermal keratinocytes foreskin keratinocyte liver
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ hematopoietic stem cells | 2.50 | n/a | 2.00 | |||
| epidermal keratinocytes | 1.53 | -0.02 | 2.00 | |||
| foreskin keratinocyte | n/a | 0.43 | 2.50 | |||
| liver | 1.94 | -3.87 | 2.50 | |||
| PC3 (prostate carcinoma) | -0.89 | 1.33 | 1.42 |
Items per page:
1 – 5 of 6