rs632185 chr11:60183960 A>G
- Sequence
ggcattctttggaagctgacttca[A/G]tgtatcaggcaaggaaaccagagc
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -0.04 | 1.20 | 2.25 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Colon_Transverse, Esophagus_Mucosa, Lung, Pancreas, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Whole_Blood