rs632870 chr11:128813943 C>G
- Sequence
cagtcttttccctgctggatcatt[C/G]tgtgcctgtgccatgaggtttctg
- ASB in cell types
- T47D (invasive ductal carcinoma)
- ASB for transcription factors
- PRGR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRGR_HUMAN | -0.55 | 1.23 | 1.70 | -1.74 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
