rs636811 chr1:233613275 T>G
- Sequence
gtcactttaaaaagaagtgacagt[T/G]gggaaagctcagtttcttctggca
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.30 | 1.29 | 2.43 | |||
| HEK293 (embryonic kidney) | 0.72 | -0.73 | 3.78 |
Items per page:
1 – 2 of 2