rs637943 chr1:78145383 C>G
- Sequence
atttgtgatcctgctaaggatcgc[C/G]ccttgacaactaaagtgtctttga
- ASB in cell types
- PC9 (lung adenocarcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.50 | 0.57 | 1.38 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), diastolic blood pressure (dbp), height, ldl cholesterol, systolic blood pressure (sbp), urinary albumin-to-creatinine ratio, waist hip ratio
GTEx eQTL Adrenal_Gland, Cells_Cultured_fibroblasts, Colon_Transverse, Liver, Lung, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Spleen, Testis