rs638515 chr12:49910144 C>T
- Sequence
cggtgagaagaatgcatttgaccc[C/T]gcgtaggcaccatcagctcaagag
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) K562 (myelogenous leukemia)
- ASB for transcription factors
- CREB1_HUMAN ZN687_HUMAN PKNX1_HUMAN CTBP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | -2.45 | 2.29 | 1.50 | n/a | No Hit | |||
| ZN687_HUMAN | -3.17 | 2.58 | 1.50 | n/a | n/a | |||
| PKNX1_HUMAN | -0.91 | 1.76 | 1.75 | n/a | No Hit | |||
| CTBP1_HUMAN | -1.46 | 1.56 | 1.67 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, irritible bowel syndrome, ldl cholesterol change with statins, obsessive-compulsive disorder (ocd), total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid