rs638517 chr11:35487690 T>G
- Sequence
tcacttctactcattctcagcaga[T/G]atttcactccctacttcccagaga
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.60 | 0.31 | 1.35 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, biploar disorder (bipolar schizoaffective disorder), irritible bowel syndrome, panic disorder