rs638537 chr11:93055155 T>G
- Sequence
cactgtttctccctcctctgggcc[T/G]cttcagattggcacagtggaaaaa
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) foreskin keratinocyte
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.02 | 0.84 | 2.12 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, ldl cholesterol change with statins, total cholesterol change with statins